Promega

SP6 Promoter Primer

Varenummer: Q5011
Kort informasjon 2 µg
  • Produktinformasjon
  • Relaterte produkter
  • Alternative produkter
  • Spesifikasjoner
The SP6 and T7 Promoter Primers are designed for sequencing inserts cloned into the pGEM Vectors. The SP6 Promoter Primer is designed for sequencing inserts cloned into the pALTER-MAX and pCI-neo Vectors. The primers are designed to be annealed to single-stranded DNA or, after alkaline denaturation, to double-stranded DNA. The promoter primers are purified by gel electrophoresis or HPLC. The T7 EEV Promoter Primer is suitable for sequencing the pALTER-MAX, pCMVTNT, pTNT and phMGFP Vectors, and the pCI/pSI series of mammalian expression vectors. Primer Sequences: (SP6) 5'-d(TATTTAGGTGACACTATAG)-3', (T7) 5'-d(TAATACGACTCACTATAGGG)-3', (T7 EEV) 5'-d(AAGGCTAGAGTACTTAATACGA)-3'.|

Det finnes ingen relaterte produkter.

Det finnes ingen alternative produkter.
Ekstra spesifikasjoner
Store at -20°C.|

Kontaktperson(er) til dette produktet

Claudia Emmanuel 951 51 950 claudia.emmanuel@nmas.no
Monica Laukas 404 40 960 monica.laukas@nmas.no

Kontakt oss

Ønsker du mer informasjon om våre produkter eller tjenester?
Fyll inn dine kontaktopplysninger og hva saken gjelder, så tar vi kontakt med deg.

Kontaktskjema
Bedrift
Telefon
E-post
Melding