Promega

pUC/M13 Primer, Forward (24mer)

Varenummer: Q5601
Kort informasjon 2 µg
  • Produktinformasjon
  • Relaterte produkter
  • Alternative produkter
  • Spesifikasjoner
The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Forward (17mer)] 5'-d(GTTTTCCCAGTCACGAC)-3', [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Reverse (22mer)] 5'-d(TCACACAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.|

Det finnes ingen relaterte produkter.

Det finnes ingen alternative produkter.
Ekstra spesifikasjoner
Store at -20°C. The primers are supplied in sterile water.|

Kontaktperson(er) til dette produktet

Claudia Emmanuel 951 51 950 claudia.emmanuel@nmas.no
Monica Laukas 404 40 960 monica.laukas@nmas.no

Kontakt oss

Ønsker du mer informasjon om våre produkter eller tjenester?
Fyll inn dine kontaktopplysninger og hva saken gjelder, så tar vi kontakt med deg.

Kontaktskjema
Bedrift
Telefon
E-post
Melding